Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 443514
End position: 443576
Length: 63

DNA sequence
>NC_020895, from 443514 to 443576 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTACCGTCGGCGGTTCCTCGTGCACGGTCGGCGGTTCCTCGTGCGCCGCCGGCGGTTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 443108-444412	Sequence	SHJGH_0360 - plasmid partitioning protein, ParB (Protein is coded in complementary strand; from 444412 to 443108)