Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4615311
End position: 4615373
Length: 63

DNA sequence
>NC_020895, from 4615311 to 4615373 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCGCCGTGACCGCCGCCGCCACCACCGTGACCGCCGCCGCCACCACCGTGACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4615272-4615577	Sequence	SHJGH_4037 - hypothetical protein