Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4879480
End position: 4879542
Length: 63

DNA sequence
>NC_020895, from 4879480 to 4879542 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGCTGGGCCGGGTCATAGCCCTGCTGGGCGGGGTCATAGCCCTGCTGGGCGGCGTCGTAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4879435-4883109	Sequence	SHJGH_4262 - hypothetical protein (Protein is coded in complementary strand; from 4883109 to 4879435)