Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5526097
End position: 5526159
Length: 63

DNA sequence
>NC_020895, from 5526097 to 5526159 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGCCCCGGCCGTCCCCGGTGCAGGTCCCGCCGTCCCCGGTGCGGGTCCCGCCGTCCCCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5523258-5528447	Sequence	SHJGH_4852 - two-component system sensor kinase/response regulator, bifunctional protein