Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5957047
End position: 5957109
Length: 63

DNA sequence
>NC_020895, from 5957047 to 5957109 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCAGGCGGAGGAGGCCCGGCAGCGGGCCGAGGAGGCCCGTCGGCGCGCGGAGGAGGAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5954711-5958040	Sequence	SHJGH_5232 - integral membrane protein with kinase activity