Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6238765
End position: 6238827
Length: 63

DNA sequence
>NC_020895, from 6238765 to 6238827 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GAGGCCCGCCGGTCCTACGACGAGAGCCGCCGCGCCTACGACGAGAGCCGCCAGGCCTACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6238415-6238882	Sequence	SHJGH_5496 - transcriptional regulator