Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8657819
End position: 8657881
Length: 63

DNA sequence
>NC_020895, from 8657819 to 8657881 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTGGGGGCGAGGGCAACGGCCGTGGGGGCGAGGGCAACCGCCGTGGCGATGAGGGCAACGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8657471-8658364	Sequence	SHJGH_7634 - integral membrane protein