Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1928442
End position: 1928513
Length: 72

DNA sequence
>NC_020895, from 1928442 to 1928513 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCTCCCGCCACTCGCGGTGACGGCGCTTCCACCACTCGCGGTGACGGCCGTTCCGCCGCTCGCGGTGAC GG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1927064-1931077	Sequence	SHJGH_1614 - putative polyketide synthase (Protein is coded in complementary strand; from 1931077 to 1927064)