Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2495051
End position: 2495122
Length: 72

DNA sequence
>NC_020895, from 2495051 to 2495122 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCCGGTGGCTCCGCCGCCCCGAGGGTCGGTGGCTCCGCCGTCCCGAGGGCCGGTGGCTCCGCCGTCGA GA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2493590-2495143	Sequence	SHJGH_2089 - permease for cytosine/purines uracil thiamine allantoin (Protein is coded in complementary strand; from 2495143 to 2493590)