Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3720932
End position: 3721003
Length: 72

DNA sequence
>NC_020895, from 3720932 to 3721003 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCAGCCGCCGCCTCCAGCCCAGCCGCCGCCTCCAGCCCAGGCGCCGTGTCCAGCCCGGGCGCCGCGTCCA GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3720479-3721498	Sequence	SHJGH_3227 - hypothetical protein (Protein is coded in complementary strand; from 3721498 to 3720479)