Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3782862
End position: 3782933
Length: 72

DNA sequence
>NC_020895, from 3782862 to 3782933 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGCCTCCGTGTCCTGGACAGCTTCCGTGTCCTTGACAGCCCCTGTGTCCTCGACAGCCTCCGTGTCCTTG AC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3782800-3783771	Sequence	SHJGH_3276 - prolipoprotein diacylglyceryl transferase (Protein is coded in complementary strand; from 3783771 to 3782800)