Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5055688
End position: 5055759
Length: 72

DNA sequence
>NC_020895, from 5055688 to 5055759 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCGGTCGTGCCCGTCGTGCCGGTCGTACCGGTCGTGCCCGTCGTACCCGTCGCGCCGGTCGTGCCCGT CG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5053719-5056592	Sequence	SHJGH_4416 - penicillin acylase (Protein is coded in complementary strand; from 5056592 to 5053719)