Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6894838
End position: 6894909
Length: 72

DNA sequence
>NC_020895, from 6894838 to 6894909 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GACGTGACGGATGTGACGAATGTGACGGACGTGACGGATGTGACGGATGTGACGGATGTGACGGATGTGA CC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6894127-6894840	Sequence	SHJGH_6088 - hypothetical protein
ORF... 6894860-6895561	Sequence	SHJGH_6089 - hypothetical protein