Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6986765
End position: 6986836
Length: 72

DNA sequence
>NC_020895, from 6986765 to 6986836 (72 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCCGCAGCAGCCCTACCCGCAGCAGCAGCCGTACCCGGCCCAGCAGCCCTACCCGCAGCAGCAGCCCTAC CC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6986650-6987498	Sequence	SHJGH_6171 - hypothetical protein