Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2501461
End position: 2501535
Length: 75

DNA sequence
>NC_020895, from 2501461 to 2501535 (75 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTGGCGCCCGCCGTCCGGGCGCTCGCCGTCTGGGCGCTCGCCGTCCGGGCGCTCGCCGTCCGGGCGCTCG CCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2500975-2501616	Sequence	SHJGH_2097 - hypothetical protein (Protein is coded in complementary strand; from 2501616 to 2500975)