Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5111589
End position: 5111663
Length: 75

DNA sequence
>NC_020895, from 5111589 to 5111663 (75 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTGCCCCCAAGGACCCTGCCCCCAAGGACACCGGCGCCAAGGACCCCGCCCCCGAGGACCCCGCCCCCGA GGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5110764-5113223	Sequence	SHJGH_4464 - D-alanyl-D-alanine carboxypeptidase