Sequence retrieval

Genome: Chlamydia trachomatis D SotonD5
Start position: 334609
End position: 334632
Length: 24

DNA sequence
>NC_020943, from 334609 to 334632 (24 bp); Chlamydia trachomatis D SotonD5 TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 334629-337433	Sequence	SOTOND5_00310 - serine/threonine-protein kinase (Protein is coded in complementary strand; from 337433 to 334629)