Sequence retrieval

Genome: Chlamydia trachomatis D SotonD5
Start position: 651030
End position: 651065
Length: 36

DNA sequence
>NC_020943, from 651030 to 651065 (36 bp); Chlamydia trachomatis D SotonD5 AAACAAGGGATTAAACAAGGGATCAAACAAGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650029-651492	Sequence	SOTOND5_00612 - Secretion system effector C (SseC) like family protein