Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 101740
End position: 101763
Length: 24

DNA sequence
>NC_021058, from 101740 to 101763 (24 bp); Sulfolobus islandicus LAL14/1 TTTTACCATTTTTCCATTTGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 101669-102685	Sequence	SiL_0115 - putative Fe-S oxidoreductase (Protein is coded in complementary strand; from 102685 to 101669)