Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 133736
End position: 133771
Length: 36

DNA sequence
>NC_021058, from 133736 to 133771 (36 bp); Sulfolobus islandicus LAL14/1 GGTGGAAGAAGATATGGAAGAAGAGGCGGAAGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 133356-133802	Sequence	SiL_0152 - Single-stranded DNA-binding replication proteinA(RPA), large (70 kD) subunit-related ssDNA-binding protein