Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 1494160
End position: 1494195
Length: 36

DNA sequence
>NC_021058, from 1494160 to 1494195 (36 bp); Sulfolobus islandicus LAL14/1 GTCGTTGTAGAAGTTGTTGTAGTAGTTGTTGTAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1493911-1495434	Sequence	SiL_1614 - Hypothetical Protein (Protein is coded in complementary strand; from 1495434 to 1493911)