Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 1691806
End position: 1691835
Length: 30

DNA sequence
>NC_021058, from 1691806 to 1691835 (30 bp); Sulfolobus islandicus LAL14/1 CTTAAATCTTCTTCAGTCTTCTTTAACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1691779-1692366	Sequence	SiL_1840 - putative sugar phosphate isomerase involved incapsule formation (Protein is coded in complementary strand; from 1692366 to 1691779)