Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 1724635
End position: 1724664
Length: 30

DNA sequence
>NC_021058, from 1724635 to 1724664 (30 bp); Sulfolobus islandicus LAL14/1 AAAGAAATTAAACGGAATTATAAGAAATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1723881-1724672	Sequence	SiL_1874 - putative nucleotide-utilizing enzyme related tomolybdopterin-biosynthesis enzyme MoeA
ORF... 1724653-1725423	Sequence	SiL_1875 - putative hydrolases or acyltransferases (alpha/beta hydrolase superfamily) (Protein is coded in complementary strand; from 1725423 to 1724653)