Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 2143484
End position: 2143507
Length: 24

DNA sequence
>NC_021058, from 2143484 to 2143507 (24 bp); Sulfolobus islandicus LAL14/1 AGTAATCGTAATAGTGATAATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2143417-2145081	Sequence	SiL_2306 - ABC-type sugar transport system, periplasmic component