Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 2191921
End position: 2191945
Length: 25

DNA sequence
>NC_021058, from 2191921 to 2191945 (25 bp); Sulfolobus islandicus LAL14/1 TTTCTCTTCTTATCTTATCTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2191143-2191970	Sequence	SiL_2352 - Hypothetical Protein (Protein is coded in complementary strand; from 2191970 to 2191143)