Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 2207234
End position: 2207263
Length: 30

DNA sequence
>NC_021058, from 2207234 to 2207263 (30 bp); Sulfolobus islandicus LAL14/1 TTAGAAGTAATTAAAAATAATTAGCAGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2207255-2207422	Sequence	SiL_2365 - Hypothetical Protein (Protein is coded in complementary strand; from 2207422 to 2207255)