Sequence retrieval

Genome: Sulfolobus islandicus LAL14/1
Start position: 414737
End position: 414784
Length: 48

DNA sequence
>NC_021058, from 414737 to 414784 (48 bp); Sulfolobus islandicus LAL14/1 ACTACAGTACTGACTATAGTACTCGCTACAGTGCTGATTACAGTACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 414644-417298	Sequence	SiL_0451 - putative solute binding protein (Protein is coded in complementary strand; from 417298 to 414644)