Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1028562
End position: 1028585
Length: 24

DNA sequence
>NC_021059, from 1028562 to 1028585 (24 bp); Staphylococcus aureus M1 TAGGTGTTGGTGTAGGCGTAGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1026593-1030363	Sequence	BN843_9590 - Bifunctional autolysin Atl / N-acetylmuramoyl-L-alanine amidase / Endo-beta-N-acetylglucosaminidase (Protein is coded in complementary strand; from 1030363 to 1026593)