Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1346619
End position: 1346642
Length: 24

DNA sequence
>NC_021059, from 1346619 to 1346642 (24 bp); Staphylococcus aureus M1 CTGCTTCTTCTTCGGCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1346558-1346920	Sequence	BN843_12630 - Large-conductance mechanosensitive channel (Protein is coded in complementary strand; from 1346920 to 1346558)