Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2135937
End position: 2135960
Length: 24

DNA sequence
>NC_021059, from 2135937 to 2135960 (24 bp); Staphylococcus aureus M1 TCTGGATCTGGTTTTGGATCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2135121-2136380	Sequence	BN843_20650 - Membrane anchored protein (Protein is coded in complementary strand; from 2136380 to 2135121)