Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 456327
End position: 456350
Length: 24

DNA sequence
>NC_021059, from 456327 to 456350 (24 bp); Staphylococcus aureus M1 GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 455981-456865	Sequence	BN843_4170 - Type I restriction-modification system,specificity subunit S