Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 458402
End position: 458425
Length: 24

DNA sequence
>NC_021059, from 458402 to 458425 (24 bp); Staphylococcus aureus M1 GAAGAAGATGAAGAAGTAGAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 457947-459455	Sequence	BN843_4190 - Hypothetical protein within Pathogenicity island SaPIn2