Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1776126
End position: 1776150
Length: 25

DNA sequence
>NC_021059, from 1776126 to 1776150 (25 bp); Staphylococcus aureus M1 TTCTTTTTTTATCTTTTCTATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1775278-1776198	Sequence	BN843_16840 - Helicase loader DnaI (Protein is coded in complementary strand; from 1776198 to 1775278)