Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1907774
End position: 1907798
Length: 25

DNA sequence
>NC_021059, from 1907774 to 1907798 (25 bp); Staphylococcus aureus M1 TTTTTTCTTTCTTTTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1907769-1908254	Sequence	BN843_17940 - Mobile element protein (Protein is coded in complementary strand; from 1908254 to 1907769)