Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2839277
End position: 2839301
Length: 25

DNA sequence
>NC_021059, from 2839277 to 2839301 (25 bp); Staphylococcus aureus M1 TTTTTTCTTTCTTTTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2839272-2839457	Sequence	BN843_27290 - Mobile element protein (Protein is coded in complementary strand; from 2839457 to 2839272)