Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 339778
End position: 339802
Length: 25

DNA sequence
>NC_021059, from 339778 to 339802 (25 bp); Staphylococcus aureus M1 AAAGAAATGAAAAAAGAAGATAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 339281-341125	Sequence	BN843_2940 - Lmo0066 homolog within ESAT-6 gene cluster,similarity to ADP-ribosylating toxins