Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 63269
End position: 63293
Length: 25

DNA sequence
>NC_021059, from 63269 to 63293 (25 bp); Staphylococcus aureus M1 TATTTTATTATATTTGATTTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 63269-63589	Sequence	BN843_580 - LysR-family regulatory protein (Protein is coded in complementary strand; from 63589 to 63269)