Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1021967
End position: 1021993
Length: 27

DNA sequence
>NC_021059, from 1021967 to 1021993 (27 bp); Staphylococcus aureus M1 TCAGGGTTGTTAGGGTTGTCAGGGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1021916-1022926	Sequence	BN843_9550 - Glutamyl endopeptidase precursor,serine proteinase SspA (Protein is coded in complementary strand; from 1022926 to 1021916)