Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1106281
End position: 1106307
Length: 27

DNA sequence
>NC_021059, from 1106281 to 1106307 (27 bp); Staphylococcus aureus M1 CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1104654-1106591	Sequence	BN843_10330 - Cell surface receptor IsdB for hemoglobin and hemoglobin-haptoglobin complexes (Protein is coded in complementary strand; from 1106591 to 1104654)