Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2102375
End position: 2102401
Length: 27

DNA sequence
>NC_021059, from 2102375 to 2102401 (27 bp); Staphylococcus aureus M1 TGTACGATTTGTACGATTTGTACGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2102365-2102844	Sequence	BN843_20110 - Phage protein (Protein is coded in complementary strand; from 2102844 to 2102365)