Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1540170
End position: 1540199
Length: 30

DNA sequence
>NC_021059, from 1540170 to 1540199 (30 bp); Staphylococcus aureus M1 TTTTGTTTCTGTATTTGTTTCTGTATTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1539346-1540224	Sequence	BN843_14240 - FIG01107889: hypothetical protein (Protein is coded in complementary strand; from 1540224 to 1539346)