Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2306480
End position: 2306509
Length: 30

DNA sequence
>NC_021059, from 2306480 to 2306509 (30 bp); Staphylococcus aureus M1 CATGTATCTTGATGCATCTTCAGGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2305872-2306909	Sequence	BN843_22200 - Macrolide-efflux protein (Protein is coded in complementary strand; from 2306909 to 2305872)