Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2788531
End position: 2788566
Length: 36

DNA sequence
>NC_021059, from 2788531 to 2788566 (36 bp); Staphylococcus aureus M1 TGGATCTTCCGATGTATCTTTCGATGCATCTTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2787239-2789146	Sequence	BN843_26840 - Predicted cell-wall-anchored protein SasF (LPXAG motif) (Protein is coded in complementary strand; from 2789146 to 2787239)