Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 1393865
End position: 1393909
Length: 45

DNA sequence
>NC_021059, from 1393865 to 1393909 (45 bp); Staphylococcus aureus M1 ATTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1393864-1394847	Sequence	BN843_13020 - Phosphate ABC transporter, periplasmic phosphate-binding protein PstS (TC 3.A.1.7.1) (Protein is coded in complementary strand; from 1394847 to 1393864)