Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2109807
End position: 2109851
Length: 45

DNA sequence
>NC_021059, from 2109807 to 2109851 (45 bp); Staphylococcus aureus M1 TATTATTAATACTTGTATTATTTAATCTTGTAATATTAATACTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2109491-2110222	Sequence	BN843_20320 - FIG01108033: hypothetical protein (Protein is coded in complementary strand; from 2110222 to 2109491)