Sequence retrieval

Genome: Staphylococcus aureus M1
Start position: 2481917
End position: 2481961
Length: 45

DNA sequence
>NC_021059, from 2481917 to 2481961 (45 bp); Staphylococcus aureus M1 TTATTATTCGCTTGGTTATTACTTGATTGGTTATTATTTGTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2481596-2482225	Sequence	BN843_24090 - hypothetical protein similar to TpgX (Protein is coded in complementary strand; from 2482225 to 2481596)