Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 325609
End position: 325632
Length: 24

DNA sequence
>NC_021083, from 325609 to 325632 (24 bp); Mycoplasma putrefaciens Mput9231 TATTTTTAATTTTATTTGTATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 325215-327830	Sequence	MPUT9231_2720 valS Valine-tRNA ligase (Protein is coded in complementary strand; from 327830 to 325215)