Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 352089
End position: 352112
Length: 24

DNA sequence
>NC_021083, from 352089 to 352112 (24 bp); Mycoplasma putrefaciens Mput9231 TTTTATCTTTATTTTTCTTTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 350594-354475	Sequence	MPUT9231_2920 - Hypothetical protein (Protein is coded in complementary strand; from 354475 to 350594)