Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 611097
End position: 611120
Length: 24

DNA sequence
>NC_021083, from 611097 to 611120 (24 bp); Mycoplasma putrefaciens Mput9231 TTGATTTTGAGTCTGATTTTGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 609202-611136	Sequence	MPUT9231_5120 - Hypothetical protein, predicted transmembrane protein, DUF285 family (Protein is coded in complementary strand; from 611136 to 609202)