Sequence retrieval

Genome: Mycoplasma putrefaciens Mput9231
Start position: 619978
End position: 620001
Length: 24

DNA sequence
>NC_021083, from 619978 to 620001 (24 bp); Mycoplasma putrefaciens Mput9231 CTGGCTCTGGATCTGGTTCTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 618216-620438	Sequence	MPUT9231_5190 - Hypothetical protein, predicted transmembrane protein, DUF285 family (Protein is coded in complementary strand; from 620438 to 618216)